Skip to product information
1 of 1

tm0141

Men's watch Romanson TM0141 MX WWH -

Men's watch Romanson TM0141 MX WWH -

Regular price 1000 ₹ INR
Regular price Sale price 1000 ₹ INR
Sale Sold out

tm0141

Men's watch Romanson TM0141 MX WWH - tm0141 Item no TM0141 Cabinet Metropolitan Charcoal grey oak veneer The Cabinet Metropolitan L is an homage to the grand steps of the MET museum and the sleek tm0141 Tom Hope Tom Hope TM0141 215,00 zł • 100 dni na zwrot • dostawa gratis • Grawer 1zł ⌚ Zamów już dzisiaj w

tm0141 BRACELET Tom Hope TM0141 CHF Marque: Tom Hope; Référence: TM0141; Taille: S Info: XS = 17 cm S= 18 cm M= 19cm L= 20cm UGS: 7350087961514 1 en

tm0141 Marker name, TM0141 Marker category, SSR Primer sequences, Fw, CAAATCAAATTTACCAAACAC Rv, GGAAACACACGGTCTCTATG ESTGenome sequences, CM0141  Compre Pulseira Tom Hope para Mulher Tm0141 - TM0141 - TOM-HOPE a preço único! Disponível na loja online ou nas lojas no Porto e em Braga

View full details